Product Class: Vector

pUC19 Vector

Catalog #SizeConcentration
N3041S50 μg1,000 μg/ml
N3041L250 μg1,000 μg/ml

Description

pUC19 is a commonly used plasmid cloning vector in E.coli. The molecule is a small double-stranded circle, 2686 base pairs in length, and has a high copy number. pUC19 carries a 54 base-pair multiple cloning site polylinker that contains unique sites for 13 different hexanucleotide-specific restriction endonucleases (1).
IMAGE WITH CAPTION
Modify text and image as needed. In order for the modal to work, must update anchor href to point to updated image.

DNASU is a central repository for plasmid clones and collections that may also be helpful.

Product Source

pUC19 is isolated from E. coli ER2272 (dam+ dcm+ EcoK M-) by a standard plasmid purification procedure.

Polylinker DNA Sequence

GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT 

GENBANK Assession Number

L09137

Properties and Usage

General Utility

Cloning

Copy Number

High (100+)

Origin of Replication

  • pMB1 (high-copy mutant)

Storage Temperature

-20°C

Storage Conditions

10 mM Tris-HCl
1 mM EDTA
pH 8.0 @ 25°C

Supporting Documents

Material Safety Datasheets

The following is a list of Material Safety Data Sheets (MSDS) that apply to this product to help you use it safely. The following file naming structure is used to name these document files: [Product Name] MSDS. For international versions please contact us at info@neb.com.

Datacards

The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.

References

  1. Yanisch-Perron, C., Vieira, J. and Messing, J. (1985). Gene. 33, 103-119.
  1. How homogeneous is the DNA/ how much is supercoiled?
  2. Are the plasmids cesium purified?
  3. What primers should I use to sequence an insert (pUC19, pNEB193, LITMUS)?

Interactive Tools