Product Class: Nucleic Acid Marker

microRNA Marker

Catalog #SizeConcentrationGel Lanes
N2102S12 ng/μl100

Description

The microRNA Marker is a set of three synthetic single-stranded RNA oligonucleotides 17, 21 and 25 residues long that have free 5´ ends (i.e., no 5´ phosphate groups). These oligonucleotides can be used as size markers on denaturing polyacrylamide gels and Northern blots. The microRNA Marker is best visualized by staining with SYBR-Gold instead of ethidium bromide (Figure 1).

The three marker oligos contain the same core sequence so they can be detected by hybridization with the same probe. The sequences of the microRNA marker band are as follows:

25-mer: 5´AGAGCAGUGGCUGGUUGAGAUUUAA 3´
21-mer: 5´AGCAGUGGCUGGUUGAGAUUU 3´
17-mer: 5´CAGUGGCUGGUUGAGAU

Note: The sequence in bold is common to all three oligos.

A 21-mer DNA oligonucleotide complementary to the marker sequences is included. This oligonucleotide is biotinylated at the 3´ end and has a free 5´ end so it can also be labeled with γ-32P-ATP and T4 Polynucleotide Kinase (NEB# M0201). The sequence of the oligonucleotide probe is as follows:

5´AAATCTCAACCAGCCACTGCT 3´-Biotin

N2102_fig_thumb

Figure 1: Lane A: 60 ng of microRNA Marker(5 µl) was loaded on a 12% denaturing polyacrylamide-urea gel which was stained with SYBR Gold (Molecular Probes) for 5 minutes and photographed on a transilluminator. Lane B: 0.2 µg of the Low Range ssRNA Marker (NEB #N0364).

Properties and Usage

Storage Temperature

-20°C

Supporting Documents

Material Safety Datasheets

The following is a list of Material Safety Data Sheets (MSDS) that apply to this product to help you use it safely. The following file naming structure is used to name these document files: [Product Name] MSDS. For international versions please contact us at info@neb.com.

Datacards

The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.

Notes

  1. The microRNA Marker is provided in a ready-to-load denaturing solution. Denature by heating for 3-5 minutes at 95°C and place on ice. Load 5-10 µl for staining with SYBR Gold in denaturing gels. In Northern blots, less than 1 µl (12 ng) is sufficient for detection by hybridization. 

    The Orange G loading buffer migrates faster than the smallest band, and migrates approximately as far as the nucleotides.
  2. Oligonucleotide Probe Usage: The provided biotinylated probe DNA oligonucleotide can be labeled with T4 Polynucleotide Kinase (NEB #M0201) and radioactive γ-32P-ATP using the following protocol: 

    1. Mix the following components in a sterile microfuge tube:

       Oligonucleotide Probe -- 1-5 µl
       10X T4 Polynucleotide Kinase reaction Buffer -- 2.0 µl
       γ-32P-ATP (5 µCi/µl) -- 1-2 µl
       T4 Polynuclotide Kinase -- 1 µl
       Sterile dH20 -- X µl
       Total volume -- 20 µl 

    2. Incubate for 30 minutes at 37°C. 

    3. Purify labeled probe using a G-25 spin column.

References

  1. Sambrook, J. and Russel, D.W. (2001). Molecular Cloning: A Laboratory Manual (3rd Ed.). 7.1-7.56.
  1. Can I use the microRNA Marker on a non-denaturing gel?
  2. Should I denature the microRNA Marker before loading on my gel?
  3. Can I visualize the microRNA Marker using EtBr staining?
  4. What is the difference between the siRNA marker and the microRNA marker (NEB #N2101S)?
  5. Can I use SYBR® with the DNA Ladders from NEB?