Product Class: Vector

pSV40-GLuc Control Plasmid

New
Catalog #SizeConcentration
N0323S20 μg500 μg/ml

Description

Highlights

  • Polylinker MCS: 1–50
  • SV40 promoter: 51-246
  • GLuc coding: 306–863
  • Start codon: 306–308
  • Stop codon: 861–863
  • Signal peptide: 306–356
  • SV40 poly-A site: 890–1111
  • SV40 enhancer: 1117–1363
  • Bacterial replication ori (pMB1): 2269–1681
  • Amp resistance: 3300–2440
The pSV40-GLuc Control Plasmid is a mammalian expression vector that encodes the secreted luciferase from the copepod Gaussia princeps as a reporter, under the control of the constitutive SV40 promoter. Gaussia luciferase (GLuc) is a 19 kDa protein encoded by a “humanized “ sequence, and it contains a native signal peptide at the N-terminus that allows it to be secreted from mammalian cells into the cell culture medium (1) There is a multiple cloning site (MCS) upstream of the SV40 promoter.

Features

  • Multiple samples can be obtained from the same transfected cells (i.e., before and after experimental treatments or at multiple time points).
  • 90–95% of GLuc activity is found in the cell culture medium, with the remaining 5–10% detectable in cell lysates. This allows flexibility when assaying GLuc along with other co-transfected reporters.
  • The activity of GLuc is high and the GLuc assay is sensitive enough to detect very small amounts of GLuc enzyme activity.
  • GLuc is very stable in the cell culture medium so the GLuc activity detected reflects the amount of GLuc secreted by the transfected cells over a period of several days. GLuc can also be stored at 4°C for several days without any loss in activity.
  • GLuc does not use the same substrate as Cypridina luciferase. Therefore, it is possible to assay both GLuc and CLuc independently in cell culture medium from cells expressing both reporters (2,3).
  • The pSV40-GLuc Control Plasmid can be transfected into cells using any standard transfection and stable cell lines can be established using Neomycin selection.
Recommended Sequencing Primers for pSV40-GLuc Control Plasmid (not available from NEB)
GLuc 3´ End Forward Primer (20-mer) 
GCCAGCAAGATCCAGGGCCA (810–829)

GLuc 5´ End Reverse Primer (24-mer) 
TCAGGGCAAACAGAACTTTGACTC (333–310)

Product Source

Isolated from an E. coli strain NEB10b by standard DNA purification procedure.

N0323

Advantages and Features

Applications

  • The pSV40-GLuc Control Plasmid can be used as a control for assessing the efficiency of transfection in mammalian cells. Plasmids containing other constitutive promoter elements are also available (see Companion Products Sold Separately).
  • GLuc can be used as a stand alone reporter or in conjunction with other compatible reporters such as Cypridina luciferase (CLuc) (2). GLuc and CLuc are ideally suited for co-expression as both are secreted and highly active enzymes providing ease of use and sensitivity (2, 3).

Properties and Usage

Storage Temperature

-20°C

Storage Conditions

10 mM Tris-HCl
1 mM EDTA
pH 7.5 @ 25°C

Supporting Documents

Material Safety Datasheets

The following is a list of Material Safety Data Sheets (MSDS) that apply to this product to help you use it safely. The following file naming structure is used to name these document files: [Product Name] MSDS. For international versions please contact us at info@neb.com.

Datacards

The Product Summary Sheet, or Data Card, includes details for how to use the product, as well as details of its formulation and quality controls. The following file naming structure is used to name the majority of these document files: [Catalog Number]Datasheet-Lot[Lot Number]. For those product lots not listed below, please contact NEB at info@neb.com or fill out the Technical Support Form for appropriate document.

References

  1. Tannous, B.A. et al. (2005). Mol. Ther.. 11, 435-443.
  2. Otsuji, et al. (2004). Anal. Biochemistry. 329, 230-237.
  3. Wu, et al. (2007). Biotechniques. 42, 290-292.
  1. Where can I find the sequence of this plasmid?
  2. Can I generate a stable cell line with pSV40-GLuc Control Plasmid?
  3. Can I transfect this plasmid into mammalian cells?
  4. How do I assay for GLuc expression?
  5. Is there another secreted reporter that can be used with GLuc?