Product Class: Restriction Endonuclease

I-CeuI
neb31 recombinant dil_B 37 65 Heat

We are excited to announce that all reaction buffers are now BSA-free. NEB began switching our BSA-containing reaction buffers in April 2021 to buffers containing Recombinant Albumin (rAlbumin) for restriction enzymes and some DNA modifying enzymes. Find more details at www.neb.com/BSA-free.

NEB restriction endonuclease that recognizes the sequence CGTAACTATAACGGTC_CTAA^GGTAGCGAA

Product Introduction

  • 100% activity in rCutSmart Buffer (over 210 enzymes are available in the same buffer) allowing for easier double digests
  • This is a homing endonuclease and requires 3 hour incubation periods
  • Tolerates some sequence degeneracy within recognition sequence
  • Restriction Enzyme Cut Site: TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
Catalog # Size Concentration
R0699S 500.0 units 5000 units/ml
R0699L 2500.0 units 5000 units/ml

Protocols, Manuals & Usage

Usage & Guidelines

Tools & Resources

Selection Charts

Web Tools

FAQs & Troubleshooting

FAQs

  1. Can a double digest be performed with PI-SceI and I-CeuI?
  2. I tested your restriction enzyme on the substrate DNA recommended by NEB, and it appears to be active, however it does not digest my DNA. What could be the reason?
  3. Can you tell me more about the switch from BSA to Recombinant Albumin (rAlbumin) in NEBuffers?

Troubleshooting

Tech Tips

I-CeuI can remain bound to DNA after cutting and alter migration rate of DNA during electrophoresis. To disrupt binding, add SDS to a final concentration of 0.5% or purify DNA before electrophoresis.