Product Class: Restriction Endonuclease

PI-SceI
NEBU recombinant dil_B 37 65 Heat ralbumin

The large size of this product was discontinued on 12/31/2020. The small size will continue to be available.

We are excited to announce that all reaction buffers are now BSA-free. NEB began switching our BSA-containing reaction buffers in April 2021 to buffers containing Recombinant Albumin (rAlbumin) for restriction enzymes and some DNA modifying enzymes. Find more details at www.neb.com/BSA-free.

NEB restriction endonuclease that recognizes the sequence ATCTATGTCGG_GTGC^GGAGAAAGAGGTAAT
Isoschizomers | Single Letter Code

Product Introduction

  • This is a homing endonuclease and requires 3 hour incubation periods
  • Tolerates some sequence degeneracy within recognition sequence
  • Restriction Enzyme Cut Site: ATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATGG (-22/-26)
Catalog # Size Concentration
R0696S 250.0 units 5000 units/ml
R0696L 1250.0 units 5000 units/ml

Featured Videos

View Video Library
  • ReduceStarActivity_video_thumb

    Reduce Star Activity with High-Fidelity Restriction Enzymes

  • StandardREProtocol_video_thumb

    Standard Protocol for Restriction Enzyme Digests

  • NEBTVEp15VLthumb280x210

    NEB® TV Ep. 15 – Applications of Restriction Enzymes

  • cuttingclose_video_thumb

    Restriction Enzyme Digest Protocol: Cutting Close to DNA End

  • dnasmear_video_thumb

    Restriction Enzyme Digestion Problem: DNA Smear on Agarose Gel

  • EnzymeNotCutting_video_thumb

    Why is My Restriction Enzyme Not Cutting DNA?

  • TooManyBands_video_thumb

    Restriction Enzyme Digest Problem: Too Many DNA Bands

  • nebcloner_dd_demo_thumb

    Double Digestion with NEBcloner

Protocols, Manuals & Usage

Protocols

  1. Restriction Digest Protocol
  2. Optimizing Restriction Endonuclease Reactions
  3. Double Digest Protocol with Standard Restriction Enzymes

Usage & Guidelines

Tools & Resources

Selection Charts

Web Tools

FAQs & Troubleshooting

FAQs

  1. Can a double digest be performed with PI-SceI and I-CeuI?
  2. Can you tell me more about the switch from BSA to Recombinant Albumin (rAlbumin) in NEBuffers?

Troubleshooting

Tech Tips

PI-SceI can remain bound to DNA after cutting and alter migration rate of DNA during electrophoresis. To disrupt binding, add SDS to a final concentration of 0.5% or purify DNA before electrophoresis.

Other Products You May Be Interested In